The Cronartium/Peridermium ITS sequence alignment
may be viewed in its entirety in Nexus format (
below), or
may be downloaded as a PAUP file: "
CronartiumITS".

Address questions regarding conditions of use to dvogler@california.com.


[FILE NAME: "CronartiumITS"; CITED IN Vogler and Bruns, (1998), Phylogenetic relationships among the pine stem rust fungi (Cronartium & Peridermium spp.), Mycologia 90 (in press).]   [USE SUBJECT TO PERMISSION OF THE AUTHORS.]   #NEXUS   [Description of taxa: IC Accession   CqeGa1 Cronartium quercuum f. sp. echinatae L76493 CcomMn1 Cronartium comptoniae L76487 FDxP10 Peridermium sp. (Powell limb rust) L76502 FIJ32 Peridermium sp. (Inyo limb rust) L76503 STwlJ6 Cronartium sp. (stalactiform limb rust) L76514 FSprP1 Cronartium arizonicum L76504 CsSr1 Cronartium coleosporioides L76500 SPC21 Cronartium coleosporioides L76513 WhSprP20 Peridermium sp. (White-spored gall rust) L76516 Ysgr4 Peridermium sp. (Yellow-spored gall rust) U75984 CrKor1 Cronartium ribicola (Korea) L76497 CrMc1 Cronartium ribicola (California) L76498 CSt2 Cronartium strobilinum L76482 CqvGa1 Cronartium quercuum f. sp. virginianae L76495 CfxP2 Peridermium harknessii U75983 CqfGa1 Cronartium quercuum f. sp. fusiforme L76494 CqQ1 Cronartium sp. (California oak rust on Quercus agrifolia) L76490 CqL1 Cronartium sp. (California oak rust on Lithocarpus densiflorus) L76489 CcL1 Cronartium conigenum L76486 CPeEl1 Cronartium comandrae (Arizona) L76481 CGcC21 Cronartium comandrae (Montana) L76480 Cc1.1 Cronartium comandrae (SE U.S.A.) L76485 BLvC8 Peridermium bethelii L76478 OMpM1 Cronartium occidentale L76507 Ca1 Cronartium appalachianum L76484 CflMV4 Cronartium flaccidum X83901 PpThet2 Peridermium pini X83912 PgW1 Pucciniastrum goeppertianum L76508 CharPe1 Chrysomyxa arctostaphyli L76488]   begin data;   dimensions ntax=29 nchar=789; format respectcase gap=- symbols="NXATGCnxatgc01234" missing=? [datatype=dna] interleave equate="a=- t=- g=- c=- N=- n=- x=- ?=-";   matrix [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 789] [CharA] [CharB] [CharC] [5.8S gene >] [< 5.8S gene] [CharD] [CharE] [Chars] CqeGa1 ATTAAAAA-----G-CAAAGGAGTGCACTTAATT--GTGGCTCTGAACCTTTTa-AATATA-TTTAAACCCATTCTX-------AAAAX----------CTCAAAGTTGTTATGTGTGCC---------TTTTTTGXGTATAGCATCTCAGCAGTAATGTCACCTTGTG--CTG--TTCTTTCACATAAGCCCTGAAAATTACCCCCCXTTTAAAAGTGACCCC--------nttTTTTTTGTTA-----XAATACTCTTtaTaaaAATGTTTTTAAGAATGT--AAG--X--CCCC-TTTAAAaaa----TAATATAACTTTTAACAATGGATCTCTTGGCTCTCACATCGATGAAGAACACAGTGAAATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCNCCTTTTGG-TATTCCAAAAGGTACACCTGTTTGAGTGTCAT--GAAA---CCCTCTCATTCCAATTCTTTATTT------TATATAA-GGA--TTTGTGTAATGGATGTTGAGTGTTGCTGTCAT-----------TGGCTCACTTTAAA-XTATATAAGTACTTTTATTTG-----------------aaaaataaatAAATGGAGTAATACTTGGTGTAATATTTA--TTATTCATTGAGGA-XGTG--TAGTT---taaTTACT-ACAGCCATTT--GTTTCAGAT--AAATAGCTTCCTAAXCCCC--------attttATCTTCAATTTTX-AGACCTCAAATCAGG--110 CcomMn1 ATTAAAAA-----G-CAAAGGAGTGCACTTTATT--GTGGCTCTGAAACTTTTa-AATATA-TTTTAACCCATTTTX-------AAAAX----------CCCAAAGTTGTTATGTGTGCC---------TTTTTTGXGTATAGCATCTCAACAGTAXCGTTAACTTGTG--TTG--TTGTTTCACATGAGCTCTGACXATTACCCCCCXTTTATAAGTGACCXX--------tttTTTTTTATTAAtattATTTACTCX---X-aaAATGTTTTTAAGAATGT--AAA--X--CCCC-TTTAAAaa-----TAATATAACTTTTAACAATGGATCTCTTGGCTCTCACATCGATGAAGAACACAGTGAAATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCTTTTGG-TATTCCAAAAGGTACACCTGTTTGAGTGTCAT--GAAX---CCCTCTCATTCCAATTCTATATTT------TATATAA-GGA--TTTGTGTAATGGATGTTGAGTGTTGCTGTCAT-----------TAGCTCACTTTAAA-XTACATAAGTACTTTTATTTG--------------------aaaaaatAAATGGAGCAATACTTGGTGTAATATTTA--TTATTCATTGAGGA-XGTG--TAGTT------XTACT-ACAGCCATTT--GTTTCAGAT--AAATAGCTTCCTAAACCCCccc----------ATTTTCAATTTTX-AGACCTCAAATCAGG--0-- FDxP10 ATTAAAAA-----G-CAAAGGAGTGCACTTTATT--GTGGCTCTGAACCTTTTa-AATATA-TTTTAACCCATTTTX-------AAAAX----------CCCAAAGTTGTTGTGTGTGCC---------TTTTTTGXGTATAGCATCTCAACAGTAXTGTTAACTTGTG--TTG--TTGTTTCACATGAGCTCTGACXATTACCCCCCXTTTATAAGTGACCXX-----------TTTTTTGTTATtattAGTTACTCX---X-aaAATGTTTTTAAGAATGT--AAA--X--CCCC-TTTAAAa------AAAXATAACTTTTAACAATGGATCTCTTGGCTCTCACATCGATGAAGAACACAGTGAAATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCAAATCTTTGAACGCACCTTGCACCTTTTGG-TATTCCAAAAGGTACACCTGTTTGAGTGTCAT--GAAA---CCCTCTCATTCCAATCCTTATATTT-----TATATAA-GGAA-TTTGTGTAATGGATGTTGAGTGTTGCTGTCAT-----------TAGCTCACTTTAAATATATATAAGTACTTTTATTTG--------------------------aAAATGGAGTAATACTTGGTGTAATATTTA--TTATTCATTGAGGA-XGTG--TAGTT------XTACT-ACAGCCATTT--GTTTCAGAT--AAATAGCTTCCTAAXCCCCccccc---attttTTTTTCAATTTTX-AGACCTCAAATCAGG--4-- FIJ32 ATTAAAAA-----G-CAAAGGAGTGCACTTTATT--GTGGCTCTGAACCTTTTa-AATATA-TTTTAACCCATTTTX-------AAAAX----------CCCAAAGTTGTTGTGTGTGCC---------TTTTTTGXGTATAGCATCTCAACAGTAXTGTTAACTTGTG--TTG--TTGTTTCACATGAGCTCTGACXATTACCCCCCXTTTATAAGTGACCXX-----------TTTTTTGTTATtattAGTTACTCX---X-aaAATGTTTTTAAGAATGT--AAA--X--CCCC-TTTAAAaa-----AAAXATAACTTTTAACAATGGATCTCTTGGCTCTCACATCGATGAAGAACACAGTGAAATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCAAATCTTTGAACGCACCTTGCACCTTTTGG-TATTCCAAAAGGTACACCTGTTTGAGTGTCAT--GAAA---CCCTCTCATTCCAATCCTTATATTT-----TATATAA-GGAA-TTTGTGTAATGGATGTTGAGTGTTGCTGTCAT-----------TAGCTCACTTTAAATATATATAAGTACTTTTATTTGaagaaaaaaaataaaataaaataaaatAAATGGAGTAATACTTGGTGTAATATTTA--TTATTCATTGAGGA-XGTG--TAGTT------XTACT-ACAGCCATTT--GTTTCAGAT--AAATAGCTTCCTAAXCCCCccc------atttTTTTTCAATTTTX-AGACCTCAAATCAGG----- STwlJ6 ATTAAAAA-----G-TAAAGGAGTGCACTTTATT--GTGGCTCTGAACCTTTTa-AATATA-TTTTAACCCATTTTX-------AAAAX----------CCCAAAGTTGTTGTGTGTGCC--------tTTTTTTGXGTATAGCATCTCAACAGTAXTGTTAACTTGTG--TTG--TTGTTTCACATGAGCTCTGACXATTACCCCCCCTTTATAAGTGACCXX---------ttTTTTTTGTTATtattAGTTACTCX---X-aaAATGTTTTTAAGAATGT--AAA--X--CCCC-TTTAAAa------AAAXATAACTTTTAACAATGGATCTCTTGGCTCTCACATCGATGAAGAACACAGTGAAATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCAAATCTTTGAATGCACCTTGCACCTTTTGG-TATTCCAAAAGGTACACCTGTTTGAGTGTCAT--GAAA---CCCTCTCATTCCAATTCTTATATTT-----TATATAA-GGAA-TTTGTGTAATGGATGTTGAGTGTTGCTGTCAT-----------TAGCTCACTTTAAATATATATAAGTACTTTTATTTG---------------aaaaatatatatATATGGAGTAATACTTGGTGTAATATTTA--TTATTCATTGAGGA-XGTG--TAGTT------XTACT-ACAGCCATTT--GTTTCAGAT--AAATAGCTTCCTAAXCCCCcc--------attTTTTTCAATTTTX-AGACCTCAAATCAGG0-4-- FSprP1 ATTAAAAA-----G-CAAAGGAGTGCACTTTATT--GTGGCTCTGAACCTTTTa-AATATA-TTTTAACCCATTTTX-------AAAAX----------CCCAAAGTTGTTGTGTGTGCC---------TTTTTTGXGTATAGCATCTCAACAGTAXTGTTAACTTGTG--TTG--TTGTTTCACATGAGCTCTGACXATTACCCCCCXTTTATAAGTGACCXX-----------TTTTTTGTTATtattAGTTACTCX---X-aaAATGTTTTTAAGAATGT--AAA--X--CCCC-TTTAAA-------AAAXATAACTTTTAACAATGGATCTCTTGGCTCTCACATCGATGAAGAACACAGTGAAATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCAAATCTTTGAATGCACCTTGCACCTTTTGG-TATTCCAAAAGGTACACCTGTTTGAGTGTCAT--GAAA---CCCTCTCATTCCAATCCTTATATTT-----TATATAA-GGAA-TTTGTGTAATGGATGTTGAGTGTTGCTGTCAT-----------TAGCTCACTTTAAATATATATAAGTACTTTTATTTG-------------------aaaaaaatAAATGGAGTAATACTTGGTGTAATATTTA--TTATTCATTGAGGA-XGTG--TAGTT------XTACT-ACAGCCATTT--GTTTCAGAT--AAATAGCTTCCTAAXCCCCccccc--atttttTTTTTCAATTTTX-AGACCTCAAATCAGG---0- CsSr1 ATTAAAAA-----G-CAAAGGAGTGCACTTTATT--GTGGCTCTGAACCTTTTa-AATATA-TTCTAACCCATTTTX-------AAAAX----------CCCAAAGTTGTTATGTGTACC---------TTTTTTGGGTATAGCATCTCAACAGTAXCGTTAACTTGTG--TTG--TTGTTTCACATGAGCTCTGACXATTACCCCCCCTTTATAAGTGACCXX-----------TTTTTTATTATtattAATTACTCX---X-aaAATGTTTTTAAGAATGT--AAA--X--CCCT-TTTAAAaaatat-ATATATAACTTTTAACAATGGATCTCTTGGCTCTCACATCGATGAAGAACACAGTGAAATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCAAATCTTTGAACGCACCTTGCACCTTTTGG-TATTCCAAAAGGTACACCTGTTTGAGTGTCAT--GAAA---CCCTCTCATTCCAATTCATTATTT------TATATAA-TGA--TTTGTGTAATGGATGTTGAGTGTTGCTGTCAT-----------TAGCTCACTTTAAA-XTATATAAGTACTTTTATTTG-------------------aaaaaaatAAATGGAGTAATACTTGGTGTAATATTTA--TTATTCATTGAGGA-XGTG--TAGTT---t--ATACT-ACAGCCATTT--GTTTCAGAT--AAATAGCTTCCTAAXCCCTc----attattttTTTTTCAATTTTX-AGACCTCAAATCAGG--301 SPC21 ATTAAAAA-----G-CAAAGGAGTGCACTTTATT--GTGGCTCTGAACCTTTTa-AATATA-TTCTAACCCATTTTX-------AAAAX----------CCCAAAGTTGTTATGTGTACC---------TTTTTTGGGTATAGCATCTCAACAGTAXCGTTAACTTGTG--TTG--TTGTTTCACATGAGCTCTGACXATTACCCCCCCTTTATAAGTGACCXX-----------TTTTTTATTATtattAATTACTCX---X-aaAATGTTTTTAAGAATGT--AAA--X--CCCC-TTTAAAaaatat-ATATATAACTTTTAACAATGGATCTCTTGGCTCTCACATCGATGAAGAACACAGTGAAATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCAAATCTTTGAACGCACCTTGCACCTTTTGG-TATTCCAAAAGGTACACCTGTTTGAGTGTCAT--GAAA---CCCTCTCATTCCAATTCATTATTT------TATATAA-TGA--TTTGTGTAATGGATGTTGAGTGTTGCTGTCAT-----------TAGCTCACTTTAAA-XTATATAAGTACTTTTATTTG-------------------aaaaaaatAAATGGAGTAATACTTGGTGTAATATTTA--TTATTCATTGAGGA-XGTG--TAGTT---t--ATACT-ACAGCCATTT--GTTTCAGAT--AAATAGCTTCCTAAXCCCTc----attattttTTTTTCAATTTTX-AGACCTCAAATCAGG--301 WhSprP20 ATTAAAAA-----G-CAAAGGAGTGCACTTAATT--GTGGCTCTGAACCTTTTa-AATATA-TTTTAACCCATTTTX-------GAAAX----------CCAAAAGTTGTTATGTGTGCC---------TTTTTTGXGTATAGCATCTCAACAGTAXTGTCAACTTGTG--TTG--TTGTTTCACATGAGCTCTGACATTTACCCCCCCCCC------------ttttttattttTATTTTATCTAttatAATTACTCTTtaTaaaAATGTTTTTAAGAATGTATAAA--X--CCCC-TTTAAAaaa----TAATATAACTTTTAACAATGGATCTCTTGGCTCTCACATCGATGAAGAACACAGTGAAATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATTGAATCTTTGAATGCACCTTGCACCTTTTGG-TATTCCAAAAGGTACACCTGTTTGAGTGTCAT--GAAA---CCCTCTCATTCCAATTCTTTATTT------TATATAA-GGA--TTTGTGTAATGGATGTTGAGTGTTGCTGTCAT-----------TGGCTCACTTTAAA-XTATATAAGTACTTTTATTTG-------------------aaaaaaatAAATGGAGTAATACTTGGTGTAATATTTA--TTATTCATTGAGGA-XGTG--TAGTT---taaTTACT-ACAGCCATTT--GTTTCAGAT--AAATGGCTTCCTAAXCCCC--------attttATTTTCAATTTTX-AGACCTCAAATCAGG-3100 Ysgr4 ATTAAAAA-----G-CAAAGGAGTGCACTTAATT--GTGGCTCTGAACCTTTTa-AATATA-TTTTAACCCATTTTX-------GAAAX----------CCAAAAGTTGTTATGTGTGCC---------TTTTTTGXGTATAGCATCTCAACAGTAXTGTCAACTTGTG--TTG--TTGTTTCACATGAGCTCTGACATTTACCCCCCCTTT--------------ttttattttTATTTTATCTAttatAATTACTCTTtaTaaaAATGTTTTTAAGAATGTATAATaaA--CCCC-TTTAAAaaa----TAATATAACTTTTAACAATGGATCTCTTGGNTCTCACATCGATGAAGAACACAGTGAAATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATTGAATCTTTGAATGCACCTTGCACCTTTTGG-TATTCCAAAAGGTACACCTGTTTGAGTGTCATgtGAAAaaaCCCTCTCATTCCAATTCTTTATTT------TATATAA-GGA--TTTGTGTAANGGATGTTGAATGTTGCTGTCAA-----------TGGCTCACTTTAAA-XTATATAAGTACTTTTATTTG-------------------aaaaaaatAAATGGAGTAATACTTGGTGTAATATTTA--TTATTCATTGAGGA-XGTG--TAGTT---taaTTACT-ACAGCCATTT--GTTTCAGAT--AAATGGCTTCCTAAXCCCC--------attttATTTTCAATTTTX-AGACCTCAAATCAGG-3100 CrKor1 ATTAAAAA-----G-CAAAGGAGTGCACTTTATT--GTGGCTCTAAACCTTTTa-AATATA-TTTTAACCCATTTTX-------AAAAX----------CCCAAAGTTGTTATGTGTGCC---------TTTTTTGXGTATAGCATCTCAACAGTAXCGTTAACTTGTG--TTG--TTGTTTCACATGAGCTCTGACXATTACCCCCCXTTTATAAGTGACCCCcc---------TTTTTTGTTA-----XATTACTCTTcaTaaaAATGTTTTTAAGAATGT--AAA--X--CCCC-TTTAAAaaaa---TGATATAACTTTTAACAATGGATCTCTTGGCTCTCACATCGATGAAGAACACAGTGAAATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATTGAATCTTTGAACGCACCTTGCACCTTTTGG-TATTCCAAAAGGTACACCTGTTTGAGTGTCAT--GAAA---CCCTCTCATTCCAATTCTTTACCT------TATATAA-GGA--GTTGTGTAATGGATGTTGAGTGTTGCTGTCAT-----------TGGCTCACTTTAAA-XTATATAAGTACTTTTATTTG-----------------aaaataaaatAAATGGAGTAATACTTGGTGTAATATTTA--TTATTCATTGAGGA-XGTG--TAGTT---taaTTACT-ACAGCCATTT--GTTTCAGAT--AAATAGCTTCCTAAXCCAC-------------ATTTTCAATTTTX-AGACCTCAAATCAGG--2-- CrMc1 ATTAAAAA-----G-CAAAGGAGTGCACTTTATT--GTGGCTCTAAACCTTTTa-AATATA-TTTTAACCCATTTTX-------AAAAX----------CCCAAAGTTGTTATGTGTGCC---------TTTTTTGXGTATAGCATCTCAACAGTAXCGTTAACTTGTG--TTG--TTGTTTCACATGAGCTCTGACXATTACCCCCCXTTTATAAGTGACCCCccc-------tTTTTTTGTTA-----XATAACTCTTtaTaaaAATGTTTTTAAGAATGT--AAA--X--CCCC-TTTAAAaaaa---AAATATAACTTTTAACAATGGATCTCTTGGCTCTCACATCGATGAAGAACACAGTGAAATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATTGAATCTTTGAACGCACCTTGCACCTTTTGG-TATTCCAAAAGGTACACCTGTTTGAGTGTCAT--GAAA---CCCTCTCATTCCAATTCTTTATTT------TATATAA-GGA--GTTGTGTAATGGATGTTGAGTGTTGCTGTCAT-----------TGGCTCACTTTAAA-XTATATAAGTACTTTTATTTG-------------------aaaaaaatAAATGGAGTAATACTTGGTGTAATATTTA--TTATTCATTGAGGA-XGTG--TAGTT---taaTTACT-ACAGCCATTT--GTTTCAGAT--AAATAGCTTCCTAAXCCAC-------------ATTTTCAATTTTX-AGACCTCAAATCAGG--20- CSt2 ATTAAAAA-----G-CAAAGGAGTGCACTTCATT--GTGGCTCTGAACCTTTTa-AATATA-TTTTAACCCATTTTX-------AAAAX----------CTCAAAGTTGTTATGTGTGCC---------TTTTTTGXGTATAGCATCTCAGCAGTAXTGTTAACTTGTG--TTG--TTGTTTCACATGAGCTCTGACTATTACCCCCCXTTTATAAGTGACCCC-------atttTATTTTATTA-----XATTACTCTTtaTaaaAATGTTTTTAAGAATGT--AAA--X--CCCC-TTTAAAaaaa---TAATATAACTTTTAACAATGGATCTCTTGGCTCTCACATCGATGAAGAACACAGTGAAATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCTTTTGG-TATTCCAAAAGGTACACCTGTTTGAGTGTCAT--GAAA---CTCTATCATTCCAATTCTTTATTT------TATATAA-GGA--TTTGTGTAATGGATGTTGAGTGTTGCTGTCAT-----------TGGCTCACTTTAAA-XTATATAAGTACTTTTATTTG-----------------------aaatAAATGGAGTAATACTTGGTGTAATATTTA--TTATTCATTGAGGA-XGTG--TAGTT---taaTTACT-ACAGCCATTT--ATTTTAGAT--AAATAGCTTCCTAAXCCCC--------aatttATCTTCAATTTTX-AGACCTCAAATCAGG-122- CqvGa1 ATTAAAAA-----G-CAAAGGAGTGCACTTAATT--GTGGCTCTGAACCTTTTa-AATATA-TTTTAACCCATTTTX-------AAAAX----------CTCAAAGTTGTTATGTGTGCC-------ttTTTTTTGXGTATAGCATCTCAGCAGTAXTGTCACCTTATG--CTG--TTATTTCACATAAGCCCTGACAATTACCCCCCXTTTATAAGTGACCCC-----------TTTTTTGTTA-----XAATACTCTTtaTaaaAATGTTTTTAAGAATGT--AAA--X--CCCC-TGTAAAaaaa---TAATATAACTTTTAACAATGGATCTCTTGGCTCTCACATCGATGAAGAACACAGTGAAATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCTTTTGG-TATTCCAAAAGGTACACCTGTTTGAGTGTCAT--GAAA---CCCTCTCATTCCAATTCTTTATTT------TATATAA-GGA--TTTGTGTAATGGATGTTGAGTGTTGCTGTCAT-----------TGGCTCACTTTAAA-XTATATGAGTACTTTTATTTG-----------------aaaaataaatAAATGGAGTAATACTTGGTGTAATATTTA--TTATTCATTGAGGA-XGTG--TAGTT---taaTTACT-ACAGCCATTT--GTTTCAGAT--AAATAGCTTCCTAAXCCCC--------attttATCTTCAATTTTX-AGACCTCAAATCAGG1-210 CfxP2 ATTAAAAA-----G-CAAAGGAGTGCACTTAATT--GTGGCTCTGAACCTTTTa-AATATA-TTTCAACCCATTTTX-------AAAAX----------ATCAAAGTTGTTATGTGTGCC-------ttTTTTTTGXGTATAGCATCTCAGCAGTAATGTCACCTTGTG--CTG--TTATTTCACATAAGCCCTGACAATTACCCCCCXTTTATAAGTGACCCC-----------TTTTTTGTTA-----XAATACTCTTtaTaaaAATGTTTTTAAGAATGT--AAA--X--CCCC-TGTAAAaaa----TAATATAACTTTTAACAATGGATCTCTTGGCTCTCACATCGATGAAGAACACAGTGAAATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCTTTTGG-TATTCCAAAAGGTACACCTGTTTGAGTGTCAT--GAAA---CCCTCTCATTCCAATTCTTTATTT------TATATAA-GGA--TTTGTGTAATGGATGTTGAGTGTTGCTGTCAT-----------TGGCTCACTTTAAA-XTATATGAGTACTTTTATTTG-----------------aaaaataaatAAATGGAGTAATACTTGGTGTAATATTTA--TTATTCATTGAGGA-XGTG--TAGTT---taaTTACT-ACAGCCATTT--GTTTCAGAT--AAATAGCTTCCTAAXCCCC--------attttATCTTCAATTTTX-AGACCTCAAATCAGG1-110 CqfGa1 ATTAAAAA-----G-CAAAGGAGTGCACTTAATT--GTGGCTCTGAACCTTTTa-AATATA-NTTTAACCCATTCTX-------AAAAX----------CTCAAAGTTGTTATGTGTGCC---------TTTTTTGXGTATAGCATCTCAGCAGTAXTGTCACCTTGTG--CTG--TTATTTCACATGAGCTCTGACAATTACCCCCCXTTTATAAGTGACCXX-------ttttTTTTTNGTTA-----XAATACTCTTtaTaaaAATGTTTTTAAGAATGT--AAA--X--CCCC-TTTAAAaaa----TAATATAACTTTTAACAATGGATCTCTTGGCTCTCACATCGATGAAGAACACAGTGAAATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATTGAATCTTTGAACGCACCTTGCACCTTTTGG-TATTCCAAAAGGTACACCTGTTTGAGTGTCAT--GAAA---CCCTCTCATTCCAATTCTTTATTT------TATATAA-GGA--TTTGTGTAATGGATGTTGAGTGTTGCTGTCAT-----------TGGCTCACTTTAAA-XTATATAAGTACTTTTATTTG-----------------aaaaataaatAAATGGAGTAATACTTGGTGTAATATTTA--TTATTCATTGAGGA-XGTG--TAGTT---taaTTGCT-ACAGCCATTT--GTTTCAGAT--AAATAGCTTCCTAAXCCCC--------attttATCTTCAATTTTX-AGACCTCAAATCAGG-2110 CqQ1 ATTAAAAA-----G-CAAAGGAGTGCACTTCATT--GTGGCTCTGAACCTTTTa-AATATA-TTTTAACCCATTTTX-------AAAAX----------CTCAAAGTTGTTATGTGTGCC---------TTTTTTGXGTATAGCATCTCAGCAGTAXTGTCACCTTGTG--TTG--TTCTTTCACATGAGCTCTGACAATTACCCCCCXTTTATAAGTGACCCC-------atttTATTTTGTTA-----XATTACTCTTtaTaaaAATGTTTTTAAGAATGT--AAA--X--CCCC-TTTAAAaa-----TAATATAACTTTTAACAATGGATCTCTTGGCTCTCACATCGATGAAGAACACAGTGAAATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCTTTTGG-TATTCCAAAAGGTACACCTGTTTGAGTGTCAT--GAAA---CCCTCTCATTCTAATTCTTCATTT------TATATAA-GGA--TTTGTGTAATGGATGTTGAGTGTTGCTGTCAT-----------TGGCTCACTTTAAA-XTATATAAGTACTTTTATTTG-------------------aaaaaaatAAATGGAGTAATACTTGGTGTAATATTTA--TTATTCATTGAGGA-XGTG--TAGTT---taaTTACT-ACAGCCATTT--GTTTCAGAT--AAATAGCTTCCTAAXCCCC--------attttATCTTCAATTTTX-AGACCTCAAATCAGG-1000 CqL1 ATTAAAAA-----G-CAAAGGAGTGCACTTCATT--GTGGCTCTGAACCTTTTa-AATATA-TTTTAACCCATTTTX-------AAAAX----------CTCAAAGTTGTTATGTGTGCC---------TTTTTTGXGTATAGCATCTCAGCAGTAXTGTCACCTTGTG--CTG--TTATTTCACATGAGCTCTGACAATTACCCCCCXTTTATAAGTGACCCC-------atttTATTTTATTA-----XATTACTCTTtaTaaaAATGTTTTTAAGAATGT--AAA--X--CCCC-TTTAAAaa-----TAATATAACTTTTAACAATGGATCTCTTGGCTCTCACATCGATGAAGAACACAGTGAAATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCTTTTGG-TATTCCAAAAGGTACACCTGTTTGAGTGTCAT--GAAA---CCCTCTCATTCCAATTCTTTATTT------GATATAA-GGA--TTTGTGTAATGGATGTTGAGTGTTGCTGTCAT-----------TGGCTCACTTTAAA-XTATATAAGTACTTTTATTTG-----------------------aaatGAATGGAGTAATACTTGGTGTAATATTTA--TTATTCATTGAGGA-XGTG--TAGTT---taaTTACT-ACAGCCATTT--GTTTTAGAT--AAATAGCTTCCTAAXCCCT--------attatATCTTCAATTTTX-AGACCTCAAATCAGG-102- CcL1 ATTAAAAA-----G-CAAAGGAGTGCACTTCATT--GTGGCTCTGAACCTTTTa-AATATA-TTTTAACCCATTTTX-------AAAAX----------CTCAAAGTTGTTATGTGTGCC---------TTTTTTGXGTATAGCATCTCAGCAGTAXTGTCAACTTGTG--TTG--TTGTTTCACATGAGCTCTGGCAATTACCCCCCXTTTATAAGTGACCCC----attttttTTCTTTATTA-----XATTACTCTTtaTaaaAATGTTTTTAAGAATGT--AAA--X--CCCC-TTTAAAaaaaa--TAATATAACTTTTAACAATGGATCTCTTGGCTCTCACATCGATGAAGAACACAGTGAAATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCTTTTGG-TATTCCAAAAGGTACACCTGTTTGAGTGTCAT--GAAA---CCCTCTCATTCCAATTCTTTATTT------TATATAA-GGA--TTTGTGTAATGGATGTTGAGTGTTGCTGTCAT-----------TGGCTCACTTTAAA-XTATATAAGTACTTTTATTTX-----------------------aaatGAATGGAGTAATACTTGGTGTAATATTTA--TTATTCATTGAGGA-XGTG--TAGTT---taaTTACT-ACAGCCATTT--GTTTCAGAT--AAATAGCTTCCTAAXCCCC--------attttATCTTCAATTTTX-AGACCTCAAATCAGG---20 CPeEl1 ATTAAAAA-----G-CAAAGGAGTGCACTTTATT--GTGGCTCTGAACCTTTTa-AATATA-ATTTAACCCATTTTX-------AAAAA----------CCCAAAGTTGTTATGTGTGCC---------TTTTTTGXGTATAGCATCTCAACAGTAXCGTTAACTTGTG--TTG--TTGTTTCACATGAGCTCTGACXATTACACCCCXTTTATAAGTGACCCX-----------TTTTTTGTTA-----XATTACTCTTtaTaaaAATGTTATTAAGAATGT--AAA--X--CCCC-TTTAAAaaaa---TAATATAACTTTTAACAATGGATCTCTTGGCTCTCACATCGATGAAGAACACAGTGAAATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCAAATCTTTGAACGCACCTTGCACCTTTTGG-TATTCCAAAAGGTACACCTGTTTGAGTGTCAT--GAAA---CCCTCTCATTCCAATTCTTTATTT------TATATAA-GGA--TTTGTGTAATGGATTTTGAGTGTTGCTGTCAT-----------TGGCTCACTTTAAA-XTATATAAGTACTTTTATTTG-----------------------aaatAAATGGAGCAATACTTGGTGTAATATTTA--TTATTCATTGAGGA-XGTG--TAGTT---taaCAACT-ACAGCCATTT--GATTCAGAT--AAATAGCTTCCTAAXCCCC-----------atTTTTTCAATTTTX-AGACCTCAAATCAGG--22- CGcC21 ATTAAAAA-----G-CAAAGGAGTGCACTTTATT--GTGGCTCTGAACCTTTTa-AATATA-ATTTAACCCATTTTX-------AAAAA----------CCCAAAGTTGTTATGTGTGCC---------TTTTTTGXGTATAGCATCTCAACAGTAXCGTTAACTTGTG--TTG--TTGTTTCACATGAGCTCTGACXATTACACCCCXTTTATAAGTGACCCX-----------TTTTTTGTTA-----XATTACTCTTtaTaaaAATGTTATTAAGAATGT--AAA--X--CCCC-TTTAAAaaaa---TAATATAACTTTTAACAATGGATCTCTTGGCTCTCACATCGATGAAGAACACAGTGAAATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCTTTTGG-TATTCCAAAAGGTACACCTGTTTGAGTGTCAT--GAAA---CCCTCTCATTCCAATTCTTTATTT------TATATAA-GGA--TTTGTGTAATGGATTTTGAGTGTTGCTGTCAT-----------TAGCTCACTTTAAA-XTATATAAGTACTTTTATTTG-----------------------taanAAATGGAGCAATACTTGGTGTAATATTTA--TTATTCATTGAGGA-XGTG--TAGTT---taaCAACT-ACAGCCATTT--GATTCAGAT--AAATAGCTTCCTAAXCCCC-------------ATTTTCAATTTTX-AGACCTCAAATCAGG--2-- Cc1.1 ATTAAAAA-----G-CAAAGGAGTGCACTTTATT--GTGGCTCTGAACCTTTTa-AATATA-ATTTAACCCATTTTX-------AAAAA----------CCCAAAGTTGTTATGTGTGCC---------TTTTTTGXGTATAGCATCTCAACAGTAXCGTTAACTTGTG--TTG--TTGTTTCACATGAGCTCTGACXATTACACCCCXTTTATAAGTGACCCX-----------TTTTTTGTTA-----XATTACTCTTtaTaaaAATGTTATTAAGAATGT--AAA--X--CCCC-TTTAAAaaaa---TAATATAACTTTTAACAATGGATCTCTTGGCTCTCACATCGATGAAGAACACAGTGAAATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCAAATCTTTGAACGCACCTTGCACCTTTTGG-TATTCCAAAAGGTACACCTGTTTGAGTGTCAT--GAAA---CTCTCTCATTCCAATTCTTTATTT------TATATAA-GGA--TTTGTGTAATGGATTTTGAGTGTTGCTGTCAT-----------TAGCTCACTTTAAA-XTATATAAGTACTTTTATTTG-----------------------aaatAAATGGAGCAATACTTGGTGTAATATTTA--TTATTCATTGAGGA-XGTG--TAGTT---taaCAACT-ACAGCCATTT--GATTCAGAT--AAATAGCTTCCTAAXCTCT---------atcaTTTTTCAATTTTX-AGACCTCAAATCAGG--22- BLvC8 ATTAAAAA-----G-CAAAGGAGTGCACTTTATT--GTGGCTCTGAACCTTTTa-AATATA-ATTTAACCCATTTTX-------AAAAA----------CCCAAAGTTGTTATGTGTGCC---------TTTTTTGXGTAGAGCATCTCAACAGTAXCGTTAACTTGTG--TTG--TTGTTTCACATGAGCTCTGACXATTACACCCCXTTTATAAGTGACCCCcccccttttttTTAATTATTATtattAATTACTCTTtaTaaaAATGTTTTTAAGAATGT--AAA--X--TCTC-TTTAAAaaaa---TAATATAACTTTTAACAATGGATCTCTTGGCTCTCACATCGATGAAGAACACAGTGAAATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATTGAATCTTTGAACGCACCTTGCACCTTTTGG-TATTCCAAAAGGTACACCTGTTTGAGTGTCAT--GAAA---CCCTCTCATTCCAATTCTTTATTT------TATATAA-GGA--TTTGTGTAATGGATTTTGAGTGTTGCTGTCAT-----------TGGCTCACTTTAAA-XTATATAAGTACTTTTATTTG--------------------aaataaaAAATGGAGCAATACTTGGTGTAATATTTA--TTATTCATTGAGGA-XGTG--TAGTT---taaCAACT-ACAGCCATTT--GATTCAGAT--AAATAGCTTCCTAAXCCCC-------------ATTTTCAATTTTX-AGACCTCAAATCAGG--2-- OMpM1 ATTAAAAA-----G-CAAAGGAGTGCACTTTATT--GTGGCTCTGAACCTTTTa-AATGTA-TTTTAACCCGTTTCX-------AAAAX----------CCCAAAGTTGTTATGTGTGCCtttttttttTCTTTTGXGTATAGCATCTCAACAGTAXCGTTAACTTGTG--TTG--TTGTTTCACATGAGCTCTGACXATTACCCCCCXTTTATAAGTGACCCX--------tttTTGTTTGTTA-----XATTACTCX---X---AATGTTTTTAAGAATGT--AAA--X--CCCC-TTTAAAa------AAATATAACTTTTAACAATGGATCTCTTGGCTCTCACATCGATGAAGAACACAGTGAAATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATTGAATCTTTGAACGCACCTTGCNCCTTTTGG-TATTCCAAAAGGTACACCTGTTTGAGTGTCAT--GAAA---CCCTCTCATTCCAATTCTTATATTt-----TATATAA-GGA-tTTTGTGTAATGGATGTTGAGTGTTGCTGTCAT-----------TGGCTCACTTTAAA-XAATATAAGTACTTTTATTTG---------------------aaaataAAATGGAGTAATACTTGGTGTAATATTTA--TTATTCATTGAGGA-XGTG--TAGTT---taaTTACT-ACAGCCATTTGTGTTTCAGATttAAATAGCTTCCTAAACCCCc------------ATTTTCAATTTTT-AGACCTCAAATCAGG-04-- Ca1 ATTAAAAA-----G-CAAAGGAGTGCACTTTATT--GTGGCTCTGAACCTTTTa-AATATA-TCTTAACCCATTTTTTttttttAAAAAaaaaaaacaaCCCAAAGTTGTTATGTGTGCC--------tTCTTTTGXGTATAGCATCTCAACAGTAXCGTTAACTTGTG--TTG--TTGTTTCACATGAGCTCTGACXATTACCCCCCXTTCATAAGTGACCCX--------tttTTTTGTACTA-----XTTTACTCTTtaTaaaAATGTCTCTAAGAATGT--AAA--X--CCCC-TTTATA-------TAATATAACTTTTAACAATGGATCTCTTGGCTCTCACATCGATGAAGAACACAGTGAAATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATTGAATCTTTGAACGCACCTTGCACCTTTTGG-TATTCCAAAAGGTACACCTGTTTGAGTGTCAT--GAAA---CCCTATCATTCTGATTCTTTATTTttatA-TATATAA-GGA--GTTGTGTAATGGATGTTGAGTGTTGCTGTCATac---------TAGCTCACTTTAAA-XTATATAAGTAATTTTATTTG-------------------aaaaaacaAAATGGAGTAATACTTGGTGTAATATTTA--TTATTCATTGAGGA-XGTG--TAGTT---ta-TTACT-ACAGCCATTT-tGTTTCAAAT--AAATAGCTTTCTAAXCCCC----------ataTTTTTCAATTTTT-AGACCTCAAATCAGG00--- CflMV4 ATTAAAAAAAaaaGGCAAAGGGGTGCCCTTTATTTtGTGGCTCTGAACCTTTTa-AATATA-TTTTAACCCATTTTT-------AAAAX----------CCCAAAGTTGTTATGTGTGCC---------TTTTTTGXGTATAGCATCTCAACAGTAXCGTTAACTTGTG--TTG--TTGTTTCACATGAGCTCTGACXATTACCCCCCXTTTATAAGTGACCCX-------ttttTTTTTTAATTa----XATTACTCTTtaTaaaAATGTTCTTAAGAATGTAAAAAaaAAaCCCC-TXTATA-------AAAXATAACTTTTAACAATGGATCTCTTGGCTCTCACATCGATGAAGAACACAGTGAAATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCAAATCTTTGAACGCACCTTGCACCTTTTGG-TATTCCAAAAGGTACACCTGTTTGAGTGTCAT--GAAA---CCCTCTCATTCCAATTCTTATATAttttTTTATATAA-GGATTTTTGTGTAATGGATGATGAGTGTTGCTATTAATtatatatataTAGCTCACTTTAAA-XTATATAAGTACTTTTATTTG---------------------aaaaatAAATGGAGTAATACTTGGTGTAATATTTATaTTATTCATTGAGGAGTGTG--TAGTTTtttaaTTACTTACAGCCATTTATTTTTCAGAT--AAATAGCTTCTTAAXCCCC------------aATTTCCATTTTTTTAGACCTCAAATCAGG-2-32 PpThet2 ATTAAAAAAAaaaGGCAAAGGGGTGCCCTTTATTTtGTGGCTCTGAACCTTTTa-AATATA-TTTTAACCCATTTTT-------AAAAX----------CCCAAAGTTGTTATGTGTGCC---------TTTTTTGXGTATAGCATCTCAACAGTAXCGTTAACTTGTG--TTG--TTGTTTCACATGAGCTCTGACXATTACCCCCCXTTTATAAGTGACCCX-------ttttTTTTTTAATTa----XATTACTCTTtaTaaaAATGTTCTTAAGAATGTAAAAAaaAAaCCCC-TXTATA-------AAAXATAACTTTTAACAATGGATCTCTTGGCTCTCACATCGATGAAGAACACAGTGAAATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCAAATCTTTGAACGCACCTTGCACCTTTTGG-TATTCCAAAAGGTACACCTGTTTGAGTGTCAT--GAAA---CCCTATCATTCCAATTCTTATATAttttTTTATATAA-GGATTTTTGTGTAATGGATGATGAGTGTTGCTATTAATtatatatataTAGCTCACTTTAAA-XTATATAAGTACTTTTATTTG---------------------aaaaatAAATGGAGTAATACTTGGTGTAATATTTATaTTATTCATTGAGGAGTGTG--TAGTTTtttaaTTACTTACAGCCATTTATTTTTCAGAT--AAATAGCTTCTTAAXCCCC------------aATTTCCATTTTTTTAGACCTCAAATCAGG-2-32 PgW1 ATTAAAAA-----GTc-AATGAGTGCACTTTATT--GTGGCTC-AAACCTTTT--AATAT-ct-TTAACCCATTATX-------AAAXX----------CCCAAAACTGTCTTGTGTACA---------TTTTATGAGTATAGCATTTCAGTAGTAXCGXCATCATGAG--CTTtaTTG-TTCAX---AGXT-TGXCXATTACCCCCCCCTTATAAGTGACCCC-------tttaTTTTTTGAAAtcat-XTAAACGTTTtaTgtaAAXGTT-tTAAGAATGT--AAA--X--CCa--TGTGGAattaaatATATATAACTTTTAACAATGGATCTCTTGGCTCTCACATCGATGAAGAACACAGTGAAATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCTTTTGG-TACTCCAAAAGGTACACCTGTTTGAGTGTCAT--GAAA---CCCTCTCATTCCAGTCTTttttttatatA-TATATAAaGGA-tTCTG-GTGATGGATGTTGAGTGTTGCCGGTGT-----------TGGCTCACTTTAAA-XTACATAAGTACTTTTATTXG---------------------ataaatAAATGGAGAAATACTTGGTGTGATATTTA--TTATTCATTGAGGAATGTGaaTAGCT---tg-cTACTTACAGCCATTTGAGTTTTXGAT--AAATAGCTTCCTAAXCCCA--------aattcATTTTGACCTTTX-AGACCTCAAATCAGG----- CharPe1 ATTAAAAAA----GTtttAAGAGTGCACTTCATT--GTGGCTCT-AACCTTTTacAATGTAcTTTTCACCCTTTTTTTt-----AAAXX----------CCCAAAACTGTTATGTGTACC--------tTTTTTTGXGTATAGCATCTCAGTAGTAXCGXCATCATGTGaaTTT--TTAATTCACa--AGXT-TGXCXATTACCCCC----------------------------TTTTTTGAAA-----XTTAACACX-taTaaaAAXGTT-cTAAGAATGT--AAA--X--CCCCcTTTAAA-------TTATATAACTTTTAACAATGGATCTCTTGGCTCTCACATCGATGAAGAACACAGTGAAATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCAAATCTTTGAACGCACCTTGCACCTTTTGGaTATTCCGAAA-GTACACCTGTTTGAGTGTCAT--GAAA---CCCTCTCATTTCAATTTT-ata--------TATATAAtTGA-gaagttGAAATGGATGTTGGGTGTTGCTGTTAT-----------TGGCTCACCTTAAA-XTATATAAGTACTTTTATTXG--------------------caaaaatAAATGGA-t-ATACTTGGTGTAATATTTA--TTATTCATTGAGGAGTGTG-gTGCCTgaaaaa-TACT-ACAGCCATTTGACTTTTXGAT--AGATAGCTTCCGAAXCCCC--------aatgtATATTATATTTTT-AGACCTCAAATCAGG0----;   endblock;   begin assumptions;   charset ITS1=1-316; charset 58SGene=317-477; charset ITS2=478-784; charset Extra=727-784;   charset Charcode=785-789; charset CharA=785; charset CharB=786; charset CharC=787; charset CharD=788; charset CharE=789;   taxset Fag=1 9-10 13-19; taxset Myr=2; taxset Scr=3-8; taxset Grs=11-12 24; taxset San=20-23 25; taxset Plu=26-27; [weight transversions:transitions 2:1] usertype weight stepmatrix=5 ATGCX . 2 1 2 1 2 . 2 1 1 1 2 . 2 1 2 1 2 . 1 1 1 1 1 .; endblock;   begin trees;   utree *blister = (CqeGa1, CcomMn1, FDxP10, FIJ32, STwlJ6, FSprP1, CsSr1, SPC21, WhSprP20, Ysgr4, (CrKor1, CrMc1,OMpM1), CSt2, CqvGa1, CfxP2, CqfGa1, CqQ1, CqL1, CcL1, CPeEl1, CGcC21, Cc1.1, BLvC8, Ca1, CflMV4, PpThet2, PgW1, CharPe1); utree *scroph = (CqeGa1, CcomMn1, (FDxP10, FIJ32, FSprP1, CsSr1, SPC21, STwlJ6), WhSprP20, Ysgr4, CrKor1, CrMc1, CSt2, CqvGa1, CfxP2, CqfGa1, CqQ1, CqL1, CcL1, CPeEl1, CGcC21, Cc1.1, BLvC8, OMpM1, Ca1,CflMV4, PpThet2, PgW1, CharPe1); utree *coleo = (CqeGa1, CcomMn1, FDxP10, FIJ32, FSprP1, (CsSr1, SPC21, STwlJ6), WhSprP20, Ysgr4, CrKor1, CrMc1, CSt2, CqvGa1, CfxP2, CqfGa1, CqQ1, CqL1, CcL1, CPeEl1, CGcC21, Cc1.1, BLvC8, OMpM1, Ca1,CflMV4, PpThet2, PgW1, CharPe1); utree *wgr = (CqeGa1, CcomMn1, FDxP10, FIJ32, STwlJ6, FSprP1, CsSr1, SPC21, (WhSprP20, Ysgr4, CfxP2), CrKor1, CrMc1, CSt2, CqvGa1, CqfGa1, CqQ1, CqL1, CcL1, CPeEl1, CGcC21, Cc1.1, BLvC8, OMpM1, Ca1, CflMV4, PpThet2, PgW1, CharPe1); utree *Wperidermium = ((FDxP10, FIJ32, WhSprP20, Ysgr4, BLvC8, CfxP2, PpThet2), CqeGa1, CcomMn1, STwlJ6, FSprP1, CsSr1, SPC21, CrKor1, CrMc1, CSt2, CqvGa1, CqfGa1, CqQ1, CqL1, CcL1, CPeEl1, CGcC21, Cc1.1, OMpM1, Ca1, CflMV4, PgW1, CharPe1); utree *NAperidermium = ((FDxP10, FIJ32, WhSprP20, Ysgr4, BLvC8, CfxP2,) PpThet2, CqeGa1, CcomMn1, STwlJ6, FSprP1, CsSr1, SPC21, CrKor1, CrMc1, CSt2, CqvGa1, CqfGa1, CqQ1, CqL1, CcL1, CPeEl1, CGcC21, Cc1.1, OMpM1, Ca1, CflMV4, PgW1, CharPe1); endblock;   begin paup; outgroup 28 29;   endblock;