ML5-ML6 Introns

This diagram shows sites of introns we know about in the ML5-ML6 region. Primers 1-9 sometimes help to work around these introns. The figure and table are from:

Bruns, T.D., T.M. Szaro, M. Gardes, K. W. Cullings, J.J. Pan, D.L. Taylor, T.R. Horton, A. Kretzer, M. Garelotto and Y. Li. 1998. A sequence database for the identification of ectomycorrhizal basidiomycetes by phylogenetic analysis. Molecular Ecology   v.7, n.3, (1998): 257-272.

Fig. 1A) Diagrammatic representation of sequenced portions of the ML5 -ML6 region. Total size of the region inclusive of primers is 416 bp in Suillus sinuspaulianus.  Most other taxa have very similar-sized fragments. The first two shaded regions indicate size-variable portions of the fragment. The 5' most region, which contains the ML5 primer sequence, was excluded from the analysis because it varies as much as 100 bp in size and the sequences are too different to be aligned. The database starts immediately after this region with the conserved sequence indicated. Most taxa have a sequence that is nearly identical to the top line. The lower line shows the variant positions that are typical of members of the Russulaceae. The second shaded region contains small inserts of less than 15 bp in some agarics; it is included in the database, but portions of it are excluded from the analysis as described in the methods. The 3' most portion of the region is not determined for most taxa in the database, because of technical difficulties associated with its proximity to the ML6 primer.
Fig.1B) Five introns encountered infrequently in the taxa sampled. Approximate locations of know introns is shown (vertical arrows, a-e). Primers that work around these are indicated (horizontal arrows) and their names and sequences are given. Flanking regions of the gene that are outside of the target fragment are shown with dashed lines.
Loc.
Primer Sequence Position relative to introns
ML5 ctcggcaaattatcctcataag interrupted by intron a
ML6 cagtagaagctgcatagggtc 3' to intron e
1
MLIN3 cgacacaggttcgtaggtag 5' to target fragment
2
ML5.5 gatcctcatagttaagaccgc 5' to intron b
3
CML5.5 tagcggtcttaactatgagg 3' to intron a, 5' to others
4
MLIN5R ttattgataccggaccac 3' to intron c, 5' to d
5
MLIN4 ggtagcaaaataaattggcc 5' to intron c, 3' to b
6
MLIN1R agttgtagagacagtgaagc 3' to intron d, 5' to e
7
MLIN2 ggccattaaatgtggtccgg interrupped by intron c
8
CML7.5 ccgccccagtcaaactgcc 3' to target fragment
9
MLIN1F gcttcactgtctctacaact 5' to intron e, 3' to others


Return to the Bruns Lab Home Page