PRIMER SEQUENCES


top Mitochondrial Primers - LrRNA gene
Name Primer Sequence Tm
ML1 GTACTTTTGCATAATGGGTCAGC
ML2 TATGTTTCGTAGAAAACCAGC 63
ML3 GCTGGTTTTCTACGAAACATATTTAAG 67
ML4 GAGGATAATTTGCCGAGTTCC 68
ML5 CTCGGCAAATTATCCTCATAAG 66
ML5.2 GGAAGCCCCGACTGTTTACT
ML5.5 GATCCTCATAGTTAAGACCGC 57
ML6 CAGTAGAAGCTGCATAGGGTC 59
ML7 GACCCTATGCAGCTTCTACTG 63
ML7.5 GGCAGTTTGACTGGGGCGG 59
ML8 TTATCCCTAGCGTAACTTTTATC 57
ML9 CGACTTATCCTATCCTCCG 63
MLIN1 GCTTCACTGTCTCTACAACT 53
MLIN1R AGTTGTAGAGACAGTGAAGC 53
MLIN2 GGCCATTAAATGTGGTCCGG 57
MLIN2R CCGGACCACATTTAATGGCC 57
MLIN3 CGACACAGGTTCGTAGGTAG 57
MLIN4 GGTAGCAAAATAAATTGGCC
MLIN5R TTATTGATACCGGACCAC
CML5.5 TAGCGGTCTTAACTATGAGG 53
CML7.5 CCGCCCCAGTCAAACTGCC 59
CTB2 GATAAAAGTTACGCTAGG 53
CTB9 CGGAGGATAGGATAAGTCG 63
CTB17 CTGACCCATTATGCAAAAGGTAC

top Mitochondrial Primers - SrRNA Gene
Name Primer Sequence Tm
MS1 CAGCAGTCAAGAATATTAGTCAATG 63
MS2 GCGGATTATCGAATTAAATAAC 53
MS4 AACCACCATTCATCGTTGAC 63
U1 TAATTTTGGTGCCGATTGAACG 57
U3 CCAAATTTGGTGCCAGAAGACTCGGTAA 77
U8 GTAGCCGTACTGGAAAGTGC 57
CU6 TGTGGCACGTCTATAGCCCA 57

top Nuclear Primers - 18S rRNA
Name Primer Sequence Tm
NS1 GTAGTCATATGCTTGTCTC 49
CNS1 GAGACAAGCATATGACTACTG 55
NS2 GGCTGCTGGCACCAGACTTGC 65
NS3 GCAAGTCTGGTGCCAGCAGCC 65
NS4 CTTCCGTCAATTCCTTTAAG {62}
NS5 AACTTAAAGGAATTGACGGAAG 55
NS6 GCATCACAGACCTGTTATTGCCTC {72}
NS7 GAGGCAATAACAGGTCTGTGATGC {72}
NS8 TCCGCAGGTTCACCTACGGA 59
TW9 TAAGCCATGCATGTCT
TW10 GCGGTAATTCCAGCTCC
TW11 GGAGTGGAGCCTGCGGCT
TW12 AAGTCGTAACAAGGTTT 53
CTW12 AAACCTTGTTACGACTT 53
NS17 CATGTCTAAGTTTAAGCAA 55
NS18 CTCATTCCAATTACAAGACC 60
NS19 CCGGAGAAGGAGCCTGAGAAAC 74
NS20 CGTCCCTATTAATCATTACG 61
NS21-ag GAATAATAGAATAGGACG 50
NS21-ls AATATACGCTATTGGAGCTGG
NS22 AATTAAGCAGACAAATCACT 57
NS23 GACTCAACACGGGAAACTC 64
NS24 AAACCTTGTTACGACTTTTA 58
NS25 GTGGTAATTCTAGAGCTAATACT
CNS25 ATGTATTAGCTCTAGAATTACCAC
NS26 CTGCCCTATCAACTTTCGA
CNS26 TCGAAAGTTGATAGGGCAG
VANS1 GTCTAGTATAATCGTTATACAGG 57
MB1 GGAGTATGGTCGCAAGGCTG
CMB1 CAGCCTTGCGACCATACTCC
MB2 GTGAGTTTCCCCGTGTTGAG 57
Basid 1 TTGCTACATGGATAACTGTG 49
Basid 2 CTGTTAAGACTACAACGG
Basid 3 AGAGTGTTCAAAGCAGGC
Basid 4 CTCACTAAGCCATTCAATCGG
NS1.5R TCTAGAGCTAATACATGC(T/C)G 52
NS2.8R GGCCCTCAAATCTAAGGATT 53
CNS2.8R AATTTGCGCGCCTGCTGCAA 57
NS3.2R CGTATATTAAAATTGTTGAC 45
CNS3.3R GACTACGAGCTTTTTAACGT 51
CNS3.5R TTTCGCAGTAGTTTGTCTTA 49
NS3.6R CAAACTACTGCGAAAGCATC 53
CNS3.6R AATGAAGTCATCCTTGGCAG 53

top Nuclear Primers - Internal Transcribed Spacer
Name Primer Sequence Tm
ITS1 TCCGTAGGTGAACCTGCGG 57
ITS1-F CTTGGTCATTTAGAGGAAGTAA 55
ITS1-P TTATCATTTAGAGGAAGGAG 49
ITS1-P2 CTTTATCATTTAGAGGAAGGAG 55
ITS1-R (t/a)TGGT(c/t)(a/g/t)(t/c)AGAGGAAGTAA
ITS2 GCTGCGTTCTTCATCGATGC 57
ITS2-Melampsora CACTGTGTTCTTCATCGACG 55
ITS2-R TGTGTTCTTCATCGATG 43
ITS3 GCATCGATGAAGAACGCAGC 57
ITS3-R ATCGATGAAGAACACAG 43
ITS4 TCCTCCGCTTATTGATATGC 53
ITS4-R CAGACTT(G/A)TA(C/T)ATGGTCCAG 53
ITS5 GGAAGTAAAAGTCGTAACAAGG {69}
ITS6R GACACTCAAACAGGTGTACC 55
ITS6R2 TCATGACACTCAAACAGGTG
ITS4-B CAGGAGACTTGTACACGGTCCAG 67

top Nuclear Primers - 28s rRNA
Name Primer Sequence Tm
CTB6 GCATATCAATAAGCGGAGG 51 {64}
NL1f TGGGTGGTAAATTCCATCTA 51
NL2f GTGAAATTGTTAAAAGGGAAAC 53
CNL2f GTTTCCCTTTTAACAATTTCAC 53
KJ1 GGCGGTAAATTCCGTCC 49
KJ2 GCTTGAAATTGTCGGGAGGG 57
TW13 GGTCCGTGTTTCAAGACG 53 {66}
CTW13 CGTCTTGAAACACGGACC 51 {66}
TW14 GCTATCCTGAGGGAAACTTC 55 {64}
CTW14 GAAGTTTCCCTCAGGATAGC {64}
TW15 CTTGGAGACCTGCTGCGG 55 {72}
CTW15 CCGCAGCAGGTCTCCAAG {72}
CNL12 CTGAACGCCTCTAAGTCAG 53
Kim-Q ACGCCTCTAAGTCAGAAT 47
Kim-Y TCGCAGAGCGAACGAGAT 51
CTB11 GCAGCAGGTCTCCAAGGTG {71}
TB11 CACCTTGGAGACCTGCTGC {71}
NL13 CAAGCGAACTTTCATCATGCACG 63
NL14 CTTTAGAACAAGGGTTGAAC 51
CNL14 GTTCAACCCTTGTTCTAAAG 51

top Nuclear Primers - 5S rDNA
Name Primer Sequence Tm
5S-Anderson CAGAGTCCTATGGCCGTGGAT 61
5S-Bruns GCATCCCGTCCGATCTGCGCAG 69
Kim-Y TCGCAGAGCGAACGAGAT 51
5S-rhizoc GTACTAACTAGGCGGCACTC 57

Last Updated: Tuesday October 22 2002
Return to the Bruns Lab Home Page